custom read 1 Search Results


90
Sangon Biotech custom read1 primer (5’ to 3’): gcctgtccgcggaagcagtggtatcaacgcagagtac
Custom Read1 Primer (5’ To 3’): Gcctgtccgcggaagcagtggtatcaacgcagagtac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom read1 primer (5’ to 3’): gcctgtccgcggaagcagtggtatcaacgcagagtac/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
custom read1 primer (5’ to 3’): gcctgtccgcggaagcagtggtatcaacgcagagtac - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Eurofins custom read 1 primer
Custom Read 1 Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom read 1 primer/product/Eurofins
Average 90 stars, based on 1 article reviews
custom read 1 primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Lexogen GmbH custom read1 sequencing primer
Custom Read1 Sequencing Primer, supplied by Lexogen GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom read1 sequencing primer/product/Lexogen GmbH
Average 90 stars, based on 1 article reviews
custom read1 sequencing primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Broad Institute Inc custom read 1 primer
Custom Read 1 Primer, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom read 1 primer/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
custom read 1 primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results