90
|
Sangon Biotech
custom read1 primer (5’ to 3’): gcctgtccgcggaagcagtggtatcaacgcagagtac Custom Read1 Primer (5’ To 3’): Gcctgtccgcggaagcagtggtatcaacgcagagtac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/custom read1 primer (5’ to 3’): gcctgtccgcggaagcagtggtatcaacgcagagtac/product/Sangon Biotech Average 90 stars, based on 1 article reviews
custom read1 primer (5’ to 3’): gcctgtccgcggaagcagtggtatcaacgcagagtac - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Eurofins
custom read 1 primer Custom Read 1 Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/custom read 1 primer/product/Eurofins Average 90 stars, based on 1 article reviews
custom read 1 primer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Lexogen GmbH
custom read1 sequencing primer Custom Read1 Sequencing Primer, supplied by Lexogen GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/custom read1 sequencing primer/product/Lexogen GmbH Average 90 stars, based on 1 article reviews
custom read1 sequencing primer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Broad Institute Inc
custom read 1 primer Custom Read 1 Primer, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/custom read 1 primer/product/Broad Institute Inc Average 90 stars, based on 1 article reviews
custom read 1 primer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |